Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 516559
End position: 516585
Length: 27

DNA sequence
>NC_001263, from 516559 to 516585 (27 bp); Deinococcus radiodurans R1 GCAGCAGCGCCAGCAGCGGCAACAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 515856-517352	Sequence	DR_0511 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 517352 to 515856)