Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 319942
End position: 319965
Length: 24

DNA sequence
>NC_001263, from 319942 to 319965 (24 bp); Deinococcus radiodurans R1 GCCGCCGACGCCGCCGACGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 319690-320682	Sequence	DR_0325 - malate dehydrogenase (Protein is coded in complementary strand; from 320682 to 319690)