Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 2387008
End position: 2387052
Length: 45

DNA sequence
>NC_001263, from 2387008 to 2387052 (45 bp); Deinococcus radiodurans R1 TTGGGTGTCCTGGGGCTGGGTGTCGTGCGGTTGGGTGTCAGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2386412-2387104	Sequence	DR_2385 - phenylacetic acid degradation protein PaaB (Protein is coded in complementary strand; from 2387104 to 2386412)