Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 2305595
End position: 2305618
Length: 24

DNA sequence
>NC_001263, from 2305595 to 2305618 (24 bp); Deinococcus radiodurans R1 CCCATGCTCATGCCCAGGCCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2304863-2306095	Sequence	DR_2307 - multidrug-efflux transporter putative (Protein is coded in complementary strand; from 2306095 to 2304863)