Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 2017169
End position: 2017213
Length: 45

DNA sequence
>NC_001263, from 2017169 to 2017213 (45 bp); Deinococcus radiodurans R1 AGACGCGGCAGGGGCAGACGCGGCAGGGTTAGGCGCGGCGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2017050-2018330	Sequence	DR_1995 - hypothetical protein (Protein is coded in complementary strand; from 2018330 to 2017050)