Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 2011137
End position: 2011166
Length: 30

DNA sequence
>NC_001263, from 2011137 to 2011166 (30 bp); Deinococcus radiodurans R1 TGGTGGTGTTGGTGGTCGTCGTGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2010710-2011231	Sequence	DR_1987 - hypothetical protein (Protein is coded in complementary strand; from 2011231 to 2010710)