Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 194022
End position: 194047
Length: 26

DNA sequence
>NC_001263, from 194022 to 194047 (26 bp); Deinococcus radiodurans R1 GTCGGCGTCGGCGTGGGCGTGGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 192846-194054	Sequence	DR_0190 - hypothetical protein (Protein is coded in complementary strand; from 194054 to 192846)