Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 1879280
End position: 1879306
Length: 27

DNA sequence
>NC_001263, from 1879280 to 1879306 (27 bp); Deinococcus radiodurans R1 CGAGCAGCGCGAGCACCGCCAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1877260-1879527	Sequence	DR_1854 - competence protein ComEC/Rec2 (Protein is coded in complementary strand; from 1879527 to 1877260)