Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 1540967
End position: 1540990
Length: 24

DNA sequence
>NC_001263, from 1540967 to 1540990 (24 bp); Deinococcus radiodurans R1 GCCGCCGCCGTCGCCACCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1539527-1541134	Sequence	DR_1524 - cephalosporin acylase (Protein is coded in complementary strand; from 1541134 to 1539527)