Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 1407957
End position: 1408006
Length: 50

DNA sequence
>NC_001263, from 1407957 to 1408006 (50 bp); Deinococcus radiodurans R1 GGGTCGGTGGCCTTCTGGTCAGTCGCCTTCTGGTCGGCGGCTTTCGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1407717-1408814	Sequence	DR_1407 - hypothetical protein (Protein is coded in complementary strand; from 1408814 to 1407717)