Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 1299463
End position: 1299500
Length: 38

DNA sequence
>NC_001263, from 1299463 to 1299500 (38 bp); Deinococcus radiodurans R1 GGGGTCTGGGCGGCGGTCTGGGCCGGGGTCGGAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1297876-1299510	Sequence	DR_1291 - D-3-phosphoglycerate dehydrogenase (Protein is coded in complementary strand; from 1299510 to 1297876)