Sequence retrieval

Genome: Chlamydophila pneumoniae CWL029
Start position: 721126
End position: 721151
Length: 26

DNA sequence
>NC_000922, from 721126 to 721151 (26 bp); Chlamydophila pneumoniae CWL029 AGAACAAAAACAAAAACAAGAGCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 720484-721857	Sequence	CPn0629 secY protein translocase subunit SecY (Protein is coded in complementary strand; from 721857 to 720484)