Sequence retrieval

Genome: Chlamydophila pneumoniae CWL029
Start position: 549814
End position: 549837
Length: 24

DNA sequence
>NC_000922, from 549814 to 549837 (24 bp); Chlamydophila pneumoniae CWL029 CATCTATATCTACATCCACATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 549804-551573	Sequence	CPn0474 - hypothetical protein (Protein is coded in complementary strand; from 551573 to 549804)