Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 953428
End position: 953460
Length: 33

DNA sequence
>NC_000915, from 953428 to 953460 (33 bp); Helicobacter pylori 26695 AAAAATTTCTTATAGATTTCTTAAACAATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 953461-954661	Sequence	HP0903m ackA acetate kinase (Protein is coded in complementary strand; from 954661 to 953461)