Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 900539
End position: 900574
Length: 36

DNA sequence
>NC_000915, from 900539 to 900574 (36 bp); Helicobacter pylori 26695 TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 899837-900733	Sequence	HP0848 - type I restriction enzyme S protein HsdS (Protein is coded in complementary strand; from 900733 to 899837)