Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 846257
End position: 846304
Length: 48

DNA sequence
>NC_000915, from 846257 to 846304 (48 bp); Helicobacter pylori 26695 TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 845540-846835	Sequence	HP0790 - anti-codon nuclease masking agent PrrB (Protein is coded in complementary strand; from 846835 to 845540)