Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 824785
End position: 824829
Length: 45

DNA sequence
>NC_000915, from 824785 to 824829 (45 bp); Helicobacter pylori 26695 TTCTTTTTTAGGAATTTCTTTTTTAGGAATTTCTTTTTTAGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 824033-825355	Sequence	HP0772 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 825355 to 824033)