Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 771064
End position: 771099
Length: 36

DNA sequence
>NC_000915, from 771064 to 771099 (36 bp); Helicobacter pylori 26695 TTTCTATTTGTTCTATTTTTTCTCTTTTTTCTATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 770469-772205	Sequence	HP0717 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 772205 to 770469)