Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 667976
End position: 668011
Length: 36

DNA sequence
>NC_000915, from 667976 to 668011 (36 bp); Helicobacter pylori 26695 ATTTGGGCGATTTTTTGGGCGATTTTTTGGGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 666410-668698	Sequence	HP0621 - recombination and DNA strand exchange inhibitor protein (Protein is coded in complementary strand; from 668698 to 666410)