Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 561060
End position: 561087
Length: 28

DNA sequence
>NC_000915, from 561060 to 561087 (28 bp); Helicobacter pylori 26695 TCTTTTCTTTTTTCTCTTTTATCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 560004-561572	Sequence	HP0528 - cag pathogenicity island protein cag8 (Protein is coded in complementary strand; from 561572 to 560004)