Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 557142
End position: 557171
Length: 30

DNA sequence
>NC_000915, from 557142 to 557171 (30 bp); Helicobacter pylori 26695 GCTTTTTTTAGCTTCTTCTAACTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 554206-559989	Sequence	HP0527 - cag pathogenicity island protein cag7 (Protein is coded in complementary strand; from 559989 to 554206)