Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 177350
End position: 177385
Length: 36

DNA sequence
>NC_000915, from 177350 to 177385 (36 bp); Helicobacter pylori 26695 CTCTTTAGCCTCCTCTTTAGCCTCCTCTTTAGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 176724-177485	Sequence	HP0170 - hypothetical protein (Protein is coded in complementary strand; from 177485 to 176724)