Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 1603376
End position: 1603405
Length: 30

DNA sequence
>NC_000915, from 1603376 to 1603405 (30 bp); Helicobacter pylori 26695 GCATTTCAATGTATTTTAATGCATTTAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1602088-1603959	Sequence	HP1523 - ATP-dependent DNA helicase RecG (Protein is coded in complementary strand; from 1603959 to 1602088)