Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 1160402
End position: 1160428
Length: 27

DNA sequence
>NC_000915, from 1160402 to 1160428 (27 bp); Helicobacter pylori 26695 TTTTCTAAATTTTCTAAGGTTTCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1160306-1162132	Sequence	HP1100 - phosphogluconate dehydratase (Protein is coded in complementary strand; from 1162132 to 1160306)