Sequence retrieval

Genome: Helicobacter pylori 26695
Start position: 1118942
End position: 1118986
Length: 45

DNA sequence
>NC_000915, from 1118942 to 1118986 (45 bp); Helicobacter pylori 26695 AGAGATATTTTCTTCAGTCATATTTCCTTCAGTCGTATTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1118208-1119062	Sequence	HP1056 - hypothetical protein (Protein is coded in complementary strand; from 1119062 to 1118208)