Sequence retrieval

Genome: Escherichia coli K-12 substr. W3110
Start position: 2777764
End position: 2777799
Length: 36

DNA sequence
>NC_000091, from 2777764 to 2777799 (36 bp); Escherichia coli K-12 substr. W3110 TGGATTTGGGTCTGGCTTTGGATCGGGTTTTGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2776802-2781382	Sequence	ypjA adhesin-like autotransporter (Protein is coded in complementary strand; from 2781382 to 2776802)