Sequence retrieval

Genome: Escherichia coli K-12 substr. W3110
Start position: 4033271
End position: 4033294
Length: 24

DNA sequence
>NC_000091, from 4033271 to 4033294 (24 bp); Escherichia coli K-12 substr. W3110 TAACGCGCTAACGCCCTGACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4031766-4033964	Sequence	zntA zinc, cobalt and lead efflux system (Protein is coded in complementary strand; from 4033964 to 4031766)