Sequence retrieval

Genome: Escherichia coli K-12 substr. W3110
Start position: 3531760
End position: 3531783
Length: 24

DNA sequence
>NC_000091, from 3531760 to 3531783 (24 bp); Escherichia coli K-12 substr. W3110 TGGTGTTGATGTTGGTTTTGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3531706-3533079	Sequence	cpxA sensory histidine kinase in two-component regulatory system with CpxR