Sequence retrieval

Genome: Escherichia coli K-12 substr. W3110
Start position: 1058571
End position: 1058594
Length: 24

DNA sequence
>NC_000091, from 1058571 to 1058594 (24 bp); Escherichia coli K-12 substr. W3110 ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1058506-1059678	Sequence	torC trimethylamine N-oxide (TMAO) reductase I, cytochrome c-type subunit